03-03-2021
Mathematics

contestada

What is the product of (6)(-10)?

Respuesta :

Madyson1610 Madyson1610

03-03-2021

the answer is -60 :)

Answer Link

BiggestBoyBrain BiggestBoyBrain

03-03-2021

Answer:

The answer is -60.

Step-by-step explanation:

Since there are no other negative values, -60 is the answer.

Please like and mark brainliest!

Hope it helps!

Answer Link

Otras preguntas

The reason why vanessa did not include sports skills activities in her program was that she:

can someone help me please

define intrinsic motivation

A train leaves new york at 4:00 pm. a second train leaves the same city in the same direction at 6:00 pm. the second train travels 60mph faster than the first.

Which sentence best describes how a business letter should be written? A business letter should have its body aligned to the right margin of the page. A busines

Attorney general a. mitchell palmer believed that he needed to protect the american people from

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Monocytes are a type of white blood cell that can differentiate into what two cells?

Each unit on the map represents 5 miles. What is the actual distance from Oceanfront to Seaside? Question 3 options: about 10 miles about 40 miles about 50 mile

together, steve and tom sold 125 raffle tickets for their school. steve sold 13 more than three times as many raffle tickets as tom. how many raffle tickets di