zenitsuAgatsuma
zenitsuAgatsuma zenitsuAgatsuma
  • 03-03-2021
  • Mathematics
contestada

I need help with 9 and 10

I need help with 9 and 10 class=

Respuesta :

coronadre25 coronadre25
  • 03-03-2021
#9 is
32divided(10-8)divided2-3
Answer Link

Otras preguntas

You have worked as a guide at the aquarium for two summers. This summer you have been offered the job again, but with a 4 percent raise. Last summer you worked
Parallel, intersecting or skew? AB and BC. AE and BF. EF and AD. Plane ABC and Plane ABF. Plane AED and Plane BFC. HELP!!!
If MATH is an isosceles trapezoid and the m∠A = 60°, what is the m∠H?
The area of a rectangular room is 750 square feet. The width of the room is 5 feet less than the length of the room. Which equations can be used to solve for y,
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
a cube has a surface area of 294 square inches what is the volume of the cube? ​
Why is it bad for a bank to give a loan to anyone who wants one?
Populations and Communities Unit Test 3 of 34Items Item 3 Two closely related species of birds live in the same tree. Species A feeds on ants and termites, whil
​It's believed that as many as 24​% of adults over 50 never graduated from high school. We wish to see if this percentage is the same among the 25 to 30 age gro
find the slope (m) and the y-intercept (b) of the given line on the graph. pls show work/explanation!