somersalex99
somersalex99 somersalex99
  • 02-03-2021
  • Mathematics
contestada

What shape is produced when slicing a right rectangular pyramid perpendicular to the base?

What shape is produced when slicing a right rectangular pyramid perpendicular to the base class=

Respuesta :

9a5f8ugdp8
9a5f8ugdp8 9a5f8ugdp8
  • 02-03-2021
C. triangle.
Pyramids are triangles to begin with you’re just making a smaller one
Answer Link

Otras preguntas

if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
where are the three parts of an atom located
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
What were the driving forces behind the industrial revolution
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?