Cynator Cynator
  • 01-02-2021
  • Mathematics
contestada

Which graph represents a function?

Which graph represents a function class=

Respuesta :

arisgryphon
arisgryphon arisgryphon
  • 01-02-2021
the bottom right

it goes like \
~\

ish.


just going by the picture it’s the only one on the second row
Answer Link

Otras preguntas

a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
Tu as quels cours le jeudi matin?
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
What are the factors of 6x + 24?