Seudónimo Seudónimo

01-10-2020
Mathematics

contestada

What the equivalent expression. 5 (3m +2p) - 4m

Respuesta :

kierabscott kierabscott

01-10-2020

hi the answer is 11m+10p

Answer Link

giuseppediaz72 giuseppediaz72

15-12-2020

Answer:

The answer is 11m+10p

Step-by-step explanation:

Answer Link

Otras preguntas

which of the following best fits the overall main idea of the "lets move" campaign?

a cube has an edge of D cm. What is the volume of the cube

What does Atticus mean when he tells Alexandra that he is “in favor of preserving Southern womanhood as much as anybody, but not for preserving polite fiction a

Through a pattern of marriage, divorce, and remarriage, some people practice __________—a succession of marriages in which a person has several spouses over a l

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Nick wants to write thank-you notes to 15 of his friends. The cards are sold in packs of 6. How many does he need to buy?

calculate the volume occupied by 0.15mol ofCO2

What moment in history came after The Middle Ages?

Paint that uses a vehicle made of wax is called _______

a rectangle field has an anrea of 40cm^2. if one side of the field is 3n longer than the other side, find the new area of the field where the length of each sid