gigi200618
gigi200618 gigi200618
  • 03-01-2020
  • English
contestada

I really need help with this-

I really need help with this class=

Respuesta :

Аноним Аноним
  • 03-01-2020

Answer:

hi there!

the correct answer to this question is: B. purchased Thomas Jefferson's library, which contained 13 books about music

Explanation:

The first library that Congress established for itself in 1800 was for legislative purposes only and, therefore, contained no music materials whatsoever. With the purchase of Thomas Jefferson's personal library in 1815, however, thirteen books on music theory and literature were added to the congressional library.

Answer Link

Otras preguntas

what is 0.00001267 is scientific notation
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
Why were the committees of correspondence powerful?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
what are 2 points on the graph for 6x-5y=25
why is it critical to your cells to be near capillaries