kevinsanchez33 kevinsanchez33
  • 01-11-2019
  • Biology
contestada

Which pair of molecules are both compounds?

Respuesta :

Аноним Аноним
  • 01-11-2019

Answer:

Ionic compounds consist of positively and negatively charged ions held together by strong electrostatic forces, whereas covalent compounds generally consist of molecules, which are groups of atoms in which one or more pairs of electrons are shared between bonded atoms.

hope this helps :)

Answer Link

Otras preguntas

Do all your pet's offspring look the same? If no, then explain why they look different.
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
The Panama Canal connects what two bodies of water?
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
Solve the equation -10 + 3x + 5x = -56 ? ??
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the range of function of y-1=(x+3)^2